|
Left Crispr |
Right Crispr |
Crispr ID |
1149840511 |
1149840518 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
17:59960636-59960658
|
17:59960689-59960711
|
Sequence |
CCTGTCTCTACTAAAAAAAGTAC |
TGTAATCCCAGCTACTCAGGAGG |
Strand |
- |
+ |
Off-target summary |
{0: 24, 1: 1074, 2: 1936, 3: 11029, 4: 218813} |
{0: 53856, 1: 140530, 2: 227977, 3: 201243, 4: 144859} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|