ID: 1149845789_1149845797

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1149845789 1149845797
Species Human (GRCh38) Human (GRCh38)
Location 17:60008844-60008866 17:60008870-60008892
Sequence CCCACAGGGTAGGTGTCTTCCCG AGCCCCACCAGGACAGGGTGTGG
Strand - +
Off-target summary No data {0: 14, 1: 1, 2: 1, 3: 29, 4: 319}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!