ID: 1149847971_1149847982

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1149847971 1149847982
Species Human (GRCh38) Human (GRCh38)
Location 17:60018380-60018402 17:60018415-60018437
Sequence CCACAGCTGCCCAAGGGCAGCAG AAGGGACCATGTGTGTTCAGTGG
Strand - +
Off-target summary No data {0: 12, 1: 3, 2: 4, 3: 24, 4: 212}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!