ID: 1149869764_1149869766

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1149869764 1149869766
Species Human (GRCh38) Human (GRCh38)
Location 17:60170892-60170914 17:60170908-60170930
Sequence CCAGTTCAGGGGGAGGTAGGGTG TAGGGTGGTAAAGAAGCAGCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 8, 4: 133} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!