ID: 1149893671_1149893684

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1149893671 1149893684
Species Human (GRCh38) Human (GRCh38)
Location 17:60412360-60412382 17:60412395-60412417
Sequence CCGGGTATGTGATGTGAACCTGT TAGTGGGGAATGGGGGCGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 233} {0: 1, 1: 0, 2: 2, 3: 17, 4: 372}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!