|
Left Crispr |
Right Crispr |
| Crispr ID |
1149893672 |
1149893684 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:60412378-60412400
|
17:60412395-60412417
|
| Sequence |
CCTGTAGTCCCAGCTACTAGTGG |
TAGTGGGGAATGGGGGCGGTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 8, 1: 238, 2: 7007, 3: 123755, 4: 255704} |
{0: 1, 1: 0, 2: 2, 3: 17, 4: 372} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|