ID: 1149897904_1149897907

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 1149897904 1149897907
Species Human (GRCh38) Human (GRCh38)
Location 17:60444451-60444473 17:60444502-60444524
Sequence CCTTCATTATTTCTAAGATCGCA TAAACTTTTCCCAACAGGCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 135} {0: 1, 1: 0, 2: 1, 3: 17, 4: 146}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!