ID: 1149909375_1149909378

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1149909375 1149909378
Species Human (GRCh38) Human (GRCh38)
Location 17:60553020-60553042 17:60553048-60553070
Sequence CCCTTTGGGGAGCTATCTCTCTT TTCCATTCATGTGTTTCAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 166} {0: 1, 1: 0, 2: 0, 3: 18, 4: 249}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!