ID: 1149949355_1149949359

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1149949355 1149949359
Species Human (GRCh38) Human (GRCh38)
Location 17:60968732-60968754 17:60968771-60968793
Sequence CCTACTACATGGTGCTGCTGAAC TGTCTCCTTTGGCCAAGTAATGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 14, 3: 37, 4: 165} {0: 1, 1: 0, 2: 2, 3: 7, 4: 168}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!