ID: 1149965573_1149965576

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 1149965573 1149965576
Species Human (GRCh38) Human (GRCh38)
Location 17:61160679-61160701 17:61160712-61160734
Sequence CCAAAATATAAAAAAGGTCATGG GATTATAGTGGACCACACTATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 30, 4: 357} {0: 1, 1: 0, 2: 0, 3: 2, 4: 47}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!