ID: 1149992779_1149992787

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1149992779 1149992787
Species Human (GRCh38) Human (GRCh38)
Location 17:61392094-61392116 17:61392128-61392150
Sequence CCCTCAGCCTCTTCCCGACTGGC ACCAGCAACCTGCTTCTGACTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 197} {0: 1, 1: 0, 2: 1, 3: 12, 4: 125}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!