ID: 1149994646_1149994651

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1149994646 1149994651
Species Human (GRCh38) Human (GRCh38)
Location 17:61400152-61400174 17:61400173-61400195
Sequence CCGGGCGCCTGGGCCGGATGTCC CCCGATGAGAGAGCCGGCGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 130} {0: 1, 1: 0, 2: 0, 3: 3, 4: 68}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!