ID: 1149994810_1149994814

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1149994810 1149994814
Species Human (GRCh38) Human (GRCh38)
Location 17:61400844-61400866 17:61400858-61400880
Sequence CCAGCGCAGAGGAGGCCCCGCGG GCCCCGCGGCTTGGCCCTGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 182} {0: 1, 1: 0, 2: 1, 3: 17, 4: 195}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!