ID: 1150003628_1150003638

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1150003628 1150003638
Species Human (GRCh38) Human (GRCh38)
Location 17:61456570-61456592 17:61456590-61456612
Sequence CCAACGCCCCCGAGCCCGCGCTG CTGGCAGCGCCGGGCCTCAGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 159} {0: 1, 1: 0, 2: 2, 3: 22, 4: 213}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!