ID: 1150005009_1150005017

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1150005009 1150005017
Species Human (GRCh38) Human (GRCh38)
Location 17:61463895-61463917 17:61463915-61463937
Sequence CCCTGCTTCAGCTGTTGGCCCAC CACCAGGAGAGAGGCAGGGCCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 166} {0: 1, 1: 0, 2: 7, 3: 110, 4: 854}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!