ID: 1150007725_1150007736

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1150007725 1150007736
Species Human (GRCh38) Human (GRCh38)
Location 17:61479958-61479980 17:61479985-61480007
Sequence CCGACTGCAGAGGTGGGGCTGCG CTGGGGGTGGGGCGGGCAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 229} {0: 1, 1: 2, 2: 20, 3: 194, 4: 1506}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!