ID: 1150028961_1150028968

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1150028961 1150028968
Species Human (GRCh38) Human (GRCh38)
Location 17:61711445-61711467 17:61711474-61711496
Sequence CCTTCAGTGCAACTTGATTCCAA TGGGATTTCTAGGGAAAAAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 124} {0: 1, 1: 0, 2: 6, 3: 40, 4: 417}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!