|
Left Crispr |
Right Crispr |
| Crispr ID |
1150029173 |
1150029175 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:61713483-61713505
|
17:61713524-61713546
|
| Sequence |
CCTGTGTAGGCCTAGGATACTAC |
ATTTTTTTTTTTTTTTGAGATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 1, 2: 4, 3: 70, 4: 396} |
{0: 3384, 1: 98629, 2: 69896, 3: 85742, 4: 127980} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|