ID: 1150065709_1150065711

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1150065709 1150065711
Species Human (GRCh38) Human (GRCh38)
Location 17:62107390-62107412 17:62107442-62107464
Sequence CCATCTGAAAAAAAAAATGCTCA TAATCAGAGGCCAGTCACAGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 18, 3: 270, 4: 1793}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!