ID: 1150069415_1150069426

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1150069415 1150069426
Species Human (GRCh38) Human (GRCh38)
Location 17:62138936-62138958 17:62138965-62138987
Sequence CCCAGCTCCATCTGCACTGGCAG GGGCTGCTCCCGCAGGGCCTCGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 6, 3: 88, 4: 485}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!