ID: 1150083399_1150083403

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1150083399 1150083403
Species Human (GRCh38) Human (GRCh38)
Location 17:62261059-62261081 17:62261088-62261110
Sequence CCTGCACACTCCTCTTAGGAGAA AGATGGAGAAATTGCAGTTCAGG
Strand - +
Off-target summary No data {0: 9, 1: 1, 2: 3, 3: 63, 4: 452}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!