ID: 1150084551_1150084558

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 1150084551 1150084558
Species Human (GRCh38) Human (GRCh38)
Location 17:62267022-62267044 17:62267062-62267084
Sequence CCTCTGGGCCAGAACAGAGGATC AAGCTGCCCTCGGGCCAGTCGGG
Strand - +
Off-target summary {0: 14, 1: 5, 2: 2, 3: 15, 4: 255} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!