ID: 1150108507_1150108527

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1150108507 1150108527
Species Human (GRCh38) Human (GRCh38)
Location 17:62478895-62478917 17:62478933-62478955
Sequence CCCCCCCGCCCTCCGCGCCGCAC CCGAGCGGGCCCCCACCTCCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 12, 3: 85, 4: 977} {0: 2, 1: 0, 2: 2, 3: 32, 4: 451}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!