ID: 1150121653_1150121657

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1150121653 1150121657
Species Human (GRCh38) Human (GRCh38)
Location 17:62608465-62608487 17:62608482-62608504
Sequence CCCAGCTTCATCTGTATTCAGGG TCAGGGATTATGATTAATTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 23, 4: 175} {0: 1, 1: 0, 2: 2, 3: 16, 4: 250}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!