ID: 1150168441_1150168446

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1150168441 1150168446
Species Human (GRCh38) Human (GRCh38)
Location 17:62966469-62966491 17:62966497-62966519
Sequence CCGCGCGCTAGGCGGAGCGAGGC CCGCCGCCGAGCCGAGCCGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 60} {0: 1, 1: 0, 2: 0, 3: 9, 4: 69}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!