|
Left Crispr |
Right Crispr |
| Crispr ID |
1150192052 |
1150192054 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:63253300-63253322
|
17:63253334-63253356
|
| Sequence |
CCTATAGAGTTATTTGAGCTCCT |
CTTATTAATCCCTTGACAGATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 16, 1: 352, 2: 713, 3: 776, 4: 726} |
{0: 2, 1: 29, 2: 594, 3: 1016, 4: 1000} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|