|
Left Crispr |
Right Crispr |
| Crispr ID |
1150192055 |
1150192057 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:63253343-63253365
|
17:63253366-63253388
|
| Sequence |
CCCTTGACAGATGGATAGTTTGC |
ACATATTTTCTCCCATTCTGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 252, 2: 4533, 3: 7742, 4: 16718} |
{0: 14, 1: 1186, 2: 2537, 3: 3546, 4: 4647} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|