ID: 1150226124_1150226133

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1150226124 1150226133
Species Human (GRCh38) Human (GRCh38)
Location 17:63525387-63525409 17:63525409-63525431
Sequence CCCAGCTGCCTTTGTGTTTACAG GGCAGGATTTCTGGGGAAGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 294} {0: 1, 1: 0, 2: 5, 3: 52, 4: 496}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!