ID: 1150228304_1150228314

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1150228304 1150228314
Species Human (GRCh38) Human (GRCh38)
Location 17:63535661-63535683 17:63535695-63535717
Sequence CCCTCCAGACCACAACCCTGATT GACAGCGCGGCTGCTGCGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 171} {0: 1, 1: 1, 2: 1, 3: 14, 4: 199}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!