|
Left Crispr |
Right Crispr |
| Crispr ID |
1150240617 |
1150240620 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:63629157-63629179
|
17:63629202-63629224
|
| Sequence |
CCTGTCGCCATGCTGGAGTTCAG |
AACCTCCGCCTCCTGTGTTCAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 5, 2: 101, 3: 373, 4: 634} |
{0: 8, 1: 568, 2: 2480, 3: 4493, 4: 5450} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|