ID: 1150250275_1150250288

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1150250275 1150250288
Species Human (GRCh38) Human (GRCh38)
Location 17:63700771-63700793 17:63700818-63700840
Sequence CCGGCCGCGAGGCTGCGGGGAGG CCGGCAGCCCCCCCAGCCCTCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 244} {0: 1, 1: 1, 2: 4, 3: 64, 4: 612}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!