ID: 1150265394_1150265405

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1150265394 1150265405
Species Human (GRCh38) Human (GRCh38)
Location 17:63829270-63829292 17:63829320-63829342
Sequence CCAGTATTGGACAAGCAGCCTTC GACTCTTGAAGGACAGGGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 82} {0: 1, 1: 0, 2: 1, 3: 23, 4: 225}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!