ID: 1150270709_1150270715

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1150270709 1150270715
Species Human (GRCh38) Human (GRCh38)
Location 17:63862655-63862677 17:63862708-63862730
Sequence CCTGGTGGGCTGGGGTGGGTGAT CTTCTGTGCTTGGGCAGGACTGG
Strand - +
Off-target summary No data {0: 3, 1: 0, 2: 1, 3: 19, 4: 198}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!