ID: 1150278324_1150278338

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 1150278324 1150278338
Species Human (GRCh38) Human (GRCh38)
Location 17:63913990-63914012 17:63914029-63914051
Sequence CCAAGTAGAAGAAGGTCCCTGCC CTCCAATGTCAGCTGGGACAGGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 0, 3: 5, 4: 129} {0: 3, 1: 1, 2: 2, 3: 20, 4: 178}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!