ID: 1150287791_1150287799

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1150287791 1150287799
Species Human (GRCh38) Human (GRCh38)
Location 17:63963715-63963737 17:63963753-63963775
Sequence CCTCGGGGCTCCCTTCTCCCCTT TGCCATTGCAGTCTTTGCCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 37, 4: 377} {0: 1, 1: 0, 2: 1, 3: 16, 4: 185}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!