ID: 1150288960_1150288970

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1150288960 1150288970
Species Human (GRCh38) Human (GRCh38)
Location 17:63970966-63970988 17:63970998-63971020
Sequence CCTCTCAAACGCCCATCCTTCCA CCATCTGCCCTCTGGTCACGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 31, 4: 411} {0: 1, 1: 0, 2: 0, 3: 18, 4: 119}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!