ID: 1150288978_1150288979

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1150288978 1150288979
Species Human (GRCh38) Human (GRCh38)
Location 17:63971033-63971055 17:63971049-63971071
Sequence CCAGGCTTTGCTGTGAGTTCTAC GTTCTACAAAAACACCAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 180} {0: 1, 1: 0, 2: 2, 3: 14, 4: 203}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!