ID: 1150292916_1150292923

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1150292916 1150292923
Species Human (GRCh38) Human (GRCh38)
Location 17:63992077-63992099 17:63992114-63992136
Sequence CCATCTGGGACTGCTGGTCACCA GGGCCGCTGCTCCCTGTCTGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 21, 4: 251}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!