ID: 1150336472_1150336484

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1150336472 1150336484
Species Human (GRCh38) Human (GRCh38)
Location 17:64334221-64334243 17:64334250-64334272
Sequence CCCCCGGGCCAGCGCCCAGCTCT TCGGCCCTGGGGCTGCTCCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 24, 4: 264} {0: 1, 1: 0, 2: 5, 3: 23, 4: 293}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!