ID: 1150336473_1150336480

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1150336473 1150336480
Species Human (GRCh38) Human (GRCh38)
Location 17:64334222-64334244 17:64334237-64334259
Sequence CCCCGGGCCAGCGCCCAGCTCTC CAGCTCTCTCTCCTCGGCCCTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 23, 4: 310} {0: 1, 1: 0, 2: 1, 3: 51, 4: 347}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!