ID: 1150368305_1150368309

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 1150368305 1150368309
Species Human (GRCh38) Human (GRCh38)
Location 17:64611609-64611631 17:64611651-64611673
Sequence CCTTCATCTGTCTACTTCTCTCT TAGTCCACCATCTACTGTCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 86, 4: 815} {0: 1, 1: 0, 2: 1, 3: 3, 4: 64}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!