ID: 1150371117_1150371130

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1150371117 1150371130
Species Human (GRCh38) Human (GRCh38)
Location 17:64638936-64638958 17:64638979-64639001
Sequence CCAGACCCCAAAAGTGCCCACAG ATAAGGAAGAGTGTAACAAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 234} {0: 1, 1: 0, 2: 1, 3: 36, 4: 369}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!