ID: 1150405194_1150405199

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1150405194 1150405199
Species Human (GRCh38) Human (GRCh38)
Location 17:64895424-64895446 17:64895465-64895487
Sequence CCAAAAGTTGAACTGTAACGCTG GCTTGATCCTGACCTGGTGTTGG
Strand - +
Off-target summary {0: 5, 1: 0, 2: 4, 3: 8, 4: 66} {0: 11, 1: 4, 2: 2, 3: 12, 4: 158}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!