ID: 1150465386_1150465392

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 1150465386 1150465392
Species Human (GRCh38) Human (GRCh38)
Location 17:65388348-65388370 17:65388369-65388391
Sequence CCTAGCCTATAAAAATGAGAGCA CAGCTGGGAATTCGAAGGCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 296} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!