ID: 1150493300_1150493305

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1150493300 1150493305
Species Human (GRCh38) Human (GRCh38)
Location 17:65589071-65589093 17:65589087-65589109
Sequence CCCACCTCACTGTGGGAACCCTG AACCCTGGTGCCCCAGATGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 242} {0: 1, 1: 0, 2: 1, 3: 4, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!