ID: 1150510005_1150510011

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1150510005 1150510011
Species Human (GRCh38) Human (GRCh38)
Location 17:65741144-65741166 17:65741196-65741218
Sequence CCTTCCTCATGAAGATTACCATA TGAATGAAAATGGCAGAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 145} {0: 1, 1: 0, 2: 1, 3: 45, 4: 463}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!