ID: 1150531199_1150531204

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 1150531199 1150531204
Species Human (GRCh38) Human (GRCh38)
Location 17:65983643-65983665 17:65983658-65983680
Sequence CCCTCCACCTTCTAACCATGAGT CCATGAGTAAAAGCTTCCTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 216} {0: 174, 1: 530, 2: 1074, 3: 3218, 4: 10932}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!