|
Left Crispr |
Right Crispr |
| Crispr ID |
1150541384 |
1150541391 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:66103776-66103798
|
17:66103824-66103846
|
| Sequence |
CCCAGCAGTGGCTACATGGCATG |
AGGAAGAGCACAGTGATTGTGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 4, 2: 18, 3: 54, 4: 199} |
{0: 2, 1: 34, 2: 71, 3: 176, 4: 437} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|