|
Left Crispr |
Right Crispr |
| Crispr ID |
1150545504 |
1150545507 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
17:66153649-66153671
|
17:66153681-66153703
|
| Sequence |
CCTGAAATGTATATGGAAATGCA |
GAATAGCCAAGGCAATCTTGAGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 1, 1: 8, 2: 52, 3: 260, 4: 969} |
{0: 2, 1: 17, 2: 68, 3: 159, 4: 393} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|