ID: 1150553378_1150553383

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1150553378 1150553383
Species Human (GRCh38) Human (GRCh38)
Location 17:66231437-66231459 17:66231463-66231485
Sequence CCTTCCTCCTTCTTTTCATCCTA CAGTCTAAAAGTCACAAGGAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 9, 3: 207, 4: 2087} {0: 1, 1: 0, 2: 1, 3: 11, 4: 161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!